OFFICIAL SITE OF THE
LABELLA LAB
Cracking the Code One Base at a Time
OUR RESEARCH
What do you see when you look at a DNA sequence like ATAGCAGCCGACCGACGACGGCA? Do you see four letters repeated at random? Encoded in these four letters are the genes that create the proteins used to build our entire bodies. But genes aren’t the only information hidden in these four letters. Using new computational methods, we can analyze genomic sequences to learn about the evolutionary past, the phenotypic present, and even about future potential. In the LaBella Lab we study the patterns encoded in DNA focusing on the following major questions
What information is encoded in “silent” synonymous genomic variation?
What role does “silent” synonymous genomic variation play in evolution?
How can genomics inform complex trait evolution?
Evolution of
Complex Traits
Every trait present in organisms today - including human diseases - are associated with evolutionary innovations in the past. Therefore, studying the evolutionary history of traits can help us reveal their underlying mechanisms and even predict how these traits may evolve in the future. We have examined the evolutionary history of complex traits in both fungi and humans. Including the evolution of human pregnancy!
Codon Usage
Bias
Why are some synonymous codons used more than others? And what can the biases in codon usage tell us? Recent studies have shown that biased codon usage affects many different cellular processes including translation and protein folding. As a result of these processes codon usage encodes information about the expression of genes. Our work harnesses this correlation to learn about ecology, evolution, and more!
The Budding
Yeasts
While you probably know Saccharomyces cerevisiae from the lab or it's products (beer, bread, wine), you may not know there are over 1,200 other budding yeast species! The budding yeast clade serves as a model group for studying evolution, codon usage, and reverse ecology. Due to the heroic efforts of the Y1000+ Collaborative we now have genomes and growth phenotypes for nearly all known species!